Stem-loop sequence gma-MIR1510a

Accession

MI0007222 (change log)

Previous IDs

gma-MIR1510

Description

Glycine max miR1510a stem-loop

Gene family

MIPF0000703; MIR1510

Literature search

17 open access papers mention gma-MIR1510a
(42 sentences)

Stem-loop

   -u       cu  a                ug    -     -   g 
5'   uauggaa  gg gggauagguaaaacaa  acug cugua uaa u
     |||||||  || ||||||||||||||||  |||| ||||| |||  
3'   guaccuu  cc ccuuauccauuuuguu  ugau gauau guu a
   au       ac  a                gu    u     u   a 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Glycine_max_v2.0; GCA_000004515.3): chr16: 31887382-31887474 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0007222

Mature sequence gma-miR1510a-5p

• Accession: MIMAT0017338
• Sequence: 13 - agggauagguaaaacaaugacugc - 36
• Evidence: experimental; Illumina [3,5], 454 [4]

Mature sequence gma-miR1510a-3p

• Accession: MIMAT0007368
• Previous IDs: gma-miR1510;gma-miR1510a
• Sequence: 61 - uuguuguuuuaccuauuccaccc - 83
• Evidence: experimental; 454 [1,4], Northern [1], cloned [2], Illumina [6]

References

1. PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2. PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
3. PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
4. PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
5. PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
6. PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).