![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR1510a |
|||||
Accession | MI0007222 (change log) | ||||
Previous IDs | gma-MIR1510 | ||||
Description | Glycine max miR1510a stem-loop | ||||
Gene family | MIPF0000703; MIR1510 | ||||
Literature search |
![]()
17 open access papers mention gma-MIR1510a | ||||
Stem-loop |
-u cu a ug - - g 5' uauggaa gg gggauagguaaaacaa acug cugua uaa u ||||||| || |||||||||||||||| |||| ||||| ||| 3' guaccuu cc ccuuauccauuuuguu ugau gauau guu a au ac a gu u u a |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR1510a-5p |
|
Accession | MIMAT0017338 |
Sequence |
13 - agggauagguaaaacaaugacugc - 36 |
Evidence | experimental; Illumina [3,5], 454 [4] |
References |
|
1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
2 |
PMID:19084500
"Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules"
Biochem Biophys Res Commun. 378:799-803(2009).
|
3 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
4 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
5 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
6 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|