Stem-loop sequence gma-MIR1511

AccessionMI0007223 (change log)
DescriptionGlycine max miR1511 stem-loop
Literature search

11 open access papers mention gma-MIR1511
(118 sentences)

Stem-loop 
   ------   g            gu    c  c    a   gu    -u   ca 
5'       uca ccgugguaucag  ccug uu auca gug  cuug  guu  a
         ||| ||||||||||||  |||| || |||| |||  ||||  |||  a
3'       agu gguaccauaguc  ggac aa uggu cac  gaac  cga  u
   aauaua   -            uc    c  u    a   --    uc   cc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr18: 20910835-20910933 [+]
intergenic
Database links

Mature sequence gma-miR1511

Accession MIMAT0007369
Sequence

70 -  

aaccaggcucugauaccaug

 - 89

Get sequence
Evidence experimental; 454 [1,3], Illumina [2,4-5]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
5
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).