Stem-loop gma-MIR1511

Accession

MI0007223

Description

Glycine max gma-MIR1511 precursor miRNA

Literature search

11 open access papers mention gma-MIR1511
(141 sentences)

Sequence

ucagccgugguaucagguccugcuucaucaaguggucuuguguucaaauccagccucaagcacaugguuAACCAGGCUCUGAUACCAUGgugaauauaa
(((.(((((((((((((.((((.((.((((.(((..((((.(((.......)))..))))))).)))).)).)))).))))))))))))))))......

Structure

------   g             u    c  c    a   gu    -u   ca 
      uca ccgugguaucagg ccug uu auca gug  cuug  guu  a
      ||| ||||||||||||| |||| || |||| |||  ||||  |||  a
      agu gGUACCAUAGUCU GGAC AA uggu cac  gaac  cga  u
aauaua   -             C    C  u    a   --    uc   cc 

Annotation confidence Not enough data

Genome context

chr18: 20910835-20910933 [+]

Mature gma-miR1511

• Accession: MIMAT0007369
• Description: Glycine max gma-miR1511 mature miRNA
• Sequence: 70 - AACCAGGCUCUGAUACCAUG - 89
• Evidence: experimental ; 454 [1,3], Illumina [2,4-5]

References

1. PubMed ID: 18402695
   Novel and nodulation-regulated microRNAs in soybean roots
   Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O
   BMC Genomics (2008) 9:160


2. PubMed ID: 20122185
   Prediction of novel miRNAs and associated target genes in Glycine max
   Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
   BMC Bioinformatics (2010) 11:S14


3. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


4. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


5. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153