Stem-loop sequence mdo-mir-1540a

AccessionMI0007263 (change log)
DescriptionMonodelphis domestica miR-1540a stem-loop
Stem-loop
   uagc              a     c   uc ---a  cc 
5'     gggggugauuccau gagcg aug  c    uc  c
       |||||||||||||| ||||| |||  |    ||   
3'     cccccacuaaggua cucgu uac  g    ag  a
   acca              c     a   ga accg  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-10 in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 580149257-580149333 [-]
antisense
Clustered miRNAs
< 10kb from mdo-mir-1540a
mdo-mir-1540bchr1: 580149267-580149325 [+]
mdo-mir-1540achr1: 580149257-580149333 [-]
Database links

Mature sequence mdo-miR-1540a

Accession MIMAT0006139
Sequence

10 - 

ugauuccauagagcgcaugu

 - 29

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1