Stem-loop sequence mdo-mir-1543

AccessionMI0007267 (change log)
DescriptionMonodelphis domestica miR-1543 stem-loop
Gene family MIPF0002080; mir-1543
Stem-loop
       -   cuu      acug   g -           cu 
5' gaua gug   ugcacc    aga u ggauuaacuuc  u
   |||| |||   ||||||    ||| | |||||||||||   
3' cugu cac   acgugg    ucu a ccugauugaag  u
       a   ---      ---a   g u           ua 
Get sequence
Deep sequencing
1058 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-174 in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 330615489-330615562 [+]
sense
ENSMODT00000041524 ; SNORA74-201; exon 1
Database links

Mature sequence mdo-miR-1543

Accession MIMAT0006142
Sequence

47 - 

uuaguccuagucuaggugcaca

 - 68

Get sequence
Deep sequencing336 reads, 2 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1