![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mdo-mir-1544a |
||||||||||||||
Accession | MI0007269 (change log) | |||||||||||||
Description | Monodelphis domestica miR-1544a stem-loop | |||||||||||||
Gene family | MIPF0001645; mir-1544 | |||||||||||||
Stem-loop |
u c ugcac u c uu acu 5' agcagc gc cc ccagggauagga ag gg c u |||||| || || |||||||||||| || || | 3' ucgucg cg gg ggucccuaucuu uc cc g g c c -ucau u - cc aag |
|||||||||||||
Deep sequencing |
| |||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||
Comments |
This sequence is referred to by the unofficial identifier Mdo-202a in [1]. |
|||||||||||||
Genome context |
|
|||||||||||||
Clustered miRNAs |
|
|||||||||||||
Database links |
Mature sequence mdo-miR-1544a-5p |
|
Accession | MIMAT0006144 |
Sequence |
13 - ugcacccagggauaggauagcg - 34 |
Deep sequencing | 39876 reads, 5 experiments |
Evidence | experimental; cloned [1], Illumina [2] |
Database links |
|
Predicted targets |
|
Mature sequence mdo-miR-1544a-3p |
|
Accession | MIMAT0026768 |
Sequence |
51 - ccuuuucuaucccugguacuggc - 73 |
Deep sequencing | 3611 reads, 5 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|