![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mdo-mir-1545a |
||||||||||||||||
Accession | MI0007270 (change log) | |||||||||||||||
Description | Monodelphis domestica miR-1545a stem-loop | |||||||||||||||
Gene family | MIPF0001711; mir-1545 | |||||||||||||||
Stem-loop |
c c c a u a -- ac 5' cgga acagugcg agggau ga aag gg uc u |||| |||||||| |||||| || ||| || || 3' gccu ugucacgu ucccua cu uuc cc ag u c u - c - a ua au |
|||||||||||||||
Deep sequencing |
| |||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||
Comments |
This sequence is referred to by the unofficial identifier Mdo-253a in [1]. |
|||||||||||||||
Genome context |
|
|||||||||||||||
Clustered miRNAs |
|
|||||||||||||||
Database links |
Mature sequence mdo-miR-1545a-5p |
|
Accession | MIMAT0026769 |
Sequence |
9 - agugcgcagggauagauaagagg - 31 |
Deep sequencing | 376 reads, 5 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
Mature sequence mdo-miR-1545a-3p |
|
Accession | MIMAT0006145 |
Sequence |
46 - acuuuccaucccuugcacugu - 66 |
Deep sequencing | 2828 reads, 5 experiments |
Evidence | experimental; cloned [1], Illumina [2] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:23034410
"Birth and expression evolution of mammalian microRNA genes"
Genome Res. 23:34-45(2013).
|