Stem-loop sequence mdo-mir-1545a

AccessionMI0007270 (change log)
DescriptionMonodelphis domestica miR-1545a stem-loop
Gene family MIPF0001711; mir-1545
Stem-loop 
   c    c        c      a  u   a  --  ac 
5'  cgga acagugcg agggau ga aag gg  uc  u
    |||| |||||||| |||||| || ||| ||  ||   
3'  gccu ugucacgu ucccua cu uuc cc  ag  u
   c    u        -      c  -   a  ua  au
Get sequence
Deep sequencing
3213 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-253a in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 14003847-14003918 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1545a
mdo-mir-1544dchrX: 14010514-14010574 [-]
mdo-mir-1545cchrX: 14007943-14008000 [-]
mdo-mir-1544achrX: 14005428-14005509 [-]
mdo-mir-1545achrX: 14003847-14003918 [-]
mdo-mir-1544c-6chrX: 13998842-13998902 [-]
mdo-mir-1545d-2chrX: 13996260-13996318 [-]
mdo-mir-1544gchrX: 13994231-13994290 [-]
Database links

Mature sequence mdo-miR-1545a-5p

Accession MIMAT0026769
Sequence

9 -  

agugcgcagggauagauaagagg

 - 31

Get sequence
Deep sequencing376 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-1545a-3p

Accession MIMAT0006145
Sequence

46 -  

acuuuccaucccuugcacugu

 - 66

Get sequence
Deep sequencing2828 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
PMID:17965199 "In vitro and in silico annotation of conserved and nonconserved microRNAs in the genome of the marsupial Monodelphis domestica" Devor EJ, Samollow PB J Hered. 99:66-72(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).