Stem-loop sequence gga-mir-1736

AccessionMI0007475 (change log)
DescriptionGallus gallus miR-1736 stem-loop
Literature search

2 open access papers mention gga-mir-1736
(6 sentences)

Stem-loop
      ga  c ug            a    u  u         ----   c a 
5' gau  ca a  agguugagggca uucc ga aggugcuga    gca c u
   |||  || |  |||||||||||| |||| || |||||||||    ||| | c
3' cua  gu u  uccaacuccugu aagg cu uccacgacu    cgu g u
      ga  c gu            c    -  -         gaaa   c a 
Get sequence
Deep sequencing
52 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 139198640-139198738 [-]
sense
ENSGALT00000027215 ; CARS2-201; intron 3
Database links

Mature sequence gga-miR-1736-5p

Accession MIMAT0007638
Previous IDsgga-miR-1736*
Sequence

18 - 

agggcaauuccugauaggugcu

 - 39

Get sequence
Deep sequencing14 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1736-3p

Accession MIMAT0007639
Previous IDsgga-miR-1736
Sequence

63 - 

agcaccuucggaacuguccuca

 - 84

Get sequence
Deep sequencing37 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).