Stem-loop vvi-MIR169q

Accession

MI0007946

Description

Vitis vinifera vvi-MIR169q precursor miRNA

Gene family

MIPF0000037; MIR169_2

Literature search

8 open access papers mention vvi-MIR169q
(15 sentences)

Sequence

360 reads, 25 reads per million, 2 experiments

aggguggaauaGAGCCAAGGAUGACUUGCCGGcauuugcaguaagucuauauuaacuggaacagccggcauguaauccuggcucuauuugguccucu
(((((.(((((((((((.((((.((.(((((((..((.((((.(((....))).)))).))..))))))).)).))))))))))))))).)))))..

Structure

--     g           A    G  U       au  g    a   c 
  agggu gaauaGAGCCA GGAU AC UGCCGGc  uu cagu agu u
  ||||| ||||||||||| |||| || |||||||  || |||| |||  
  uccug uuuaucucggu ccua ug acggccg  aa guca uua a
uc     g           -    a  u       ac  g    a   u 

Annotation confidence Not enough data

Genome context

chr11: 16384484-16384580 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from vvi-MIR169q

Mature vvi-miR169q

• Accession: MIMAT0006551
• Description: Vitis vinifera vvi-miR169q mature miRNA
• Sequence: 12 - GAGCCAAGGAUGACUUGCCGG - 32
• Evidence: experimental ; Array [2]

References

1. PubMed ID: 17721507
   The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
   "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
   "Nature (2007) 449:463-467


2. PubMed ID: 19939267
   High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
   Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
   BMC Genomics (2009) 10:558