Stem-loop vvi-MIR169w

Accession

MI0007948

Description

Vitis vinifera vvi-MIR169w precursor miRNA

Gene family

MIPF0000037; MIR169_2

Literature search

8 open access papers mention vvi-MIR169w
(21 sentences)

Sequence

3661 reads, 246 reads per million, 2 experiments

gguuauguggugCAGCCAAGGAUGACUUGCCGGcaacucccuuuauuguacucaugcaugcucauacuuauacuguugugggcaucauuuaaguggcaaaaaugguggucggcgagucauucuuagcuacauuucugccucau
(((...(.((((.(((.(((((((((((((((((....((.(((.(((((((.(((.((((((((((.......).))))))))))))...))).))))))).))..))))))))))))))))).))).)))).).)))....

Structure

----   uau u    C   C                 aacu  c   a    -   --c   c         - uu 
    ggu   g ggug AGC AAGGAUGACUUGCCGGc    cc uuu uugu acu   aug augcucaua c  a
    |||   | |||| ||| |||||||||||||||||    || ||| |||| |||   ||| ||||||||| |  u
    ccg   c uuac ucg uucuuacugagcggcug    gg aaa aacg uga   uac uacgggugu g  a
uacu   --u u    a   a                 --gu  u   -    g   auu   -         u uc 

Annotation confidence Not enough data

Genome context

chr14: 29685614-29685756 [+]

Mature vvi-miR169w

• Accession: MIMAT0006553
• Description: Vitis vinifera vvi-miR169w mature miRNA
• Sequence: 13 - CAGCCAAGGAUGACUUGCCGG - 33
• Evidence: experimental ; Array [2]

References

1. PubMed ID: 17721507
   The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla
   "Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro"
   "Nature (2007) 449:463-467


2. PubMed ID: 19939267
   High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera
   Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pè ME, Horner DS
   BMC Genomics (2009) 10:558