Stem-loop sequence cfa-mir-376a-1

AccessionMI0008143 (change log)
Previous IDscfa-mir-376-1
DescriptionCanis familiaris miR-376a-1 stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
   --  a    c    u      --gua   u 
5'   gu gauu uccu cuauga     cau a
     || |||| |||| ||||||     ||| u
3'   ca cuaa agga gauacu     gua u
   ug  c    a    -      aauua   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69271259-69271316 [+]
sense
ENSCAFT00000040914 ; cfa-mir-376a-1-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-376a-1
cfa-mir-494chr8: 69261385-69261465 [+]
cfa-mir-543chr8: 69263406-69263463 [+]
cfa-mir-495chr8: 69265169-69265226 [+]
cfa-mir-3958chr8: 69267134-69267274 [+]
cfa-mir-376a-3chr8: 69269752-69269810 [+]
cfa-mir-376cchr8: 69270100-69270185 [+]
cfa-mir-376a-2chr8: 69270499-69270556 [+]
cfa-mir-376bchr8: 69270858-69270956 [+]
cfa-mir-376a-1chr8: 69271259-69271316 [+]
cfa-mir-300chr8: 69271815-69271892 [+]
cfa-mir-1185chr8: 69273204-69273332 [+]
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
cfa-mir-544chr8: 69277656-69277744 [+]
cfa-mir-487achr8: 69281078-69281157 [+]
Database links

Mature sequence cfa-miR-376a

Accession MIMAT0006722
Previous IDscfa-miR-376
Sequence

38 - 

aucauagaggaaaauccacgu

 - 58

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).