Stem-loop sequence cfa-mir-487b

AccessionMI0008144 (change log)
Previous IDscfa-mir-487
DescriptionCanis familiaris miR-487b stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   --    uuau      c u     uuuua 
5'   gugg    cccugu c guucg     c
     ||||    |||||| | |||||      
3'   cacc    gggaca g uaagc     u
   uu    uacu      u c     uguac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69275496-69275553 [+]
sense
ENSCAFT00000034937 ; cfa-mir-487b-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-487b
cfa-mir-3958chr8: 69267134-69267274 [+]
cfa-mir-376a-3chr8: 69269752-69269810 [+]
cfa-mir-376cchr8: 69270100-69270185 [+]
cfa-mir-376a-2chr8: 69270499-69270556 [+]
cfa-mir-376bchr8: 69270858-69270956 [+]
cfa-mir-376a-1chr8: 69271259-69271316 [+]
cfa-mir-300chr8: 69271815-69271892 [+]
cfa-mir-1185chr8: 69273204-69273332 [+]
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
cfa-mir-544chr8: 69277656-69277744 [+]
cfa-mir-487achr8: 69281078-69281157 [+]
cfa-mir-382chr8: 69283123-69283179 [+]
cfa-mir-134chr8: 69283496-69283568 [+]
cfa-mir-485chr8: 69284239-69284297 [+]
Database links

Mature sequence cfa-miR-487b

Accession MIMAT0006723
Previous IDscfa-miR-487
Sequence

37 - 

aaucguacagggucauccacuu

 - 58

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).