Stem-loop sequence cfa-mir-382

AccessionMI0008145 (change log)
DescriptionCanis familiaris miR-382 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   ---aa           ug      - uuu 
5'      guuguucgugg  gauucg c   a
        |||||||||||  |||||| |   c
3'      caacaggcacu  cuaagc g   u
   uuuca           ua      a uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69283123-69283179 [+]
antisense
ENSCAFT00000032593 ; cfa-mir-382-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-382
cfa-mir-1185chr8: 69273204-69273332 [+]
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
cfa-mir-544chr8: 69277656-69277744 [+]
cfa-mir-487achr8: 69281078-69281157 [+]
cfa-mir-382chr8: 69283123-69283179 [+]
cfa-mir-134chr8: 69283496-69283568 [+]
cfa-mir-485chr8: 69284239-69284297 [+]
cfa-mir-496chr8: 69289410-69289507 [+]
cfa-mir-377chr8: 69290937-69291005 [+]
Database links

Mature sequence cfa-miR-382

Accession MIMAT0006724
Sequence

36 - 

aaucauucacggacaacacuuu

 - 57

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).