Stem-loop sequence cfa-mir-485

AccessionMI0008146 (change log)
DescriptionCanis familiaris miR-485 stem-loop
Gene family MIPF0000201; mir-485
Stem-loop
   --     cu       -    a    auuc 
5'   agagg  ggccgug auga uucg    a
     |||||  ||||||| |||| ||||    u
3'   ucucc  ucggcac uacu gagc    c
   uc     uc       a    -    gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69284239-69284297 [+]
sense
ENSCAFT00000039920 ; cfa-mir-485-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-485
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
cfa-mir-544chr8: 69277656-69277744 [+]
cfa-mir-487achr8: 69281078-69281157 [+]
cfa-mir-382chr8: 69283123-69283179 [+]
cfa-mir-134chr8: 69283496-69283568 [+]
cfa-mir-485chr8: 69284239-69284297 [+]
cfa-mir-496chr8: 69289410-69289507 [+]
cfa-mir-377chr8: 69290937-69291005 [+]
cfa-mir-409chr8: 69293782-69293835 [+]
cfa-mir-369chr8: 69294073-69294128 [+]
Database links

Mature sequence cfa-miR-485

Accession MIMAT0006725
Sequence

1 - 

agaggcuggccgugaugaauucg

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).