Stem-loop sequence sly-MIR1919a

AccessionMI0008354 (change log)
DescriptionSolanum lycopersicum miR1919a stem-loop
Gene family MIPF0000582; MIR1919
Literature search

7 open access papers mention sly-MIR1919a
(17 sentences)

Stem-loop
           g                        a    gu   uaagccccuuucucuaag 
5' aucuuccg uaguccugucgcagaugacucucg ucuu  cau                  u
   |||||||| |||||||||||||||||||||||| ||||  |||                  c
3' uagaaggu auuaggacagugucuacugagagc agga  gug                  u
           -                        -    ug   uaacuuaaguuuaauuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 56612335-56612457 [+]
intergenic
Database links

Mature sequence sly-miR1919a

Accession MIMAT0007911
Sequence

91 - 

acgagagucaucugugacagg

 - 111

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).