Stem-loop sequence sly-MIR1919c

AccessionMI0008356 (change log)
DescriptionSolanum lycopersicum miR1919c stem-loop
Gene family MIPF0000582; MIR1919
Literature search

6 open access papers mention sly-MIR1919c
(14 sentences)

Stem-loop
             uucac        gua                      c  auuuauaga      ---cu   uuu 
5' gccuuugaug     aucuuccg   guccugucgcagaugacuuucg cc         accaca     uuc   a
   ||||||||||     ||||||||   |||||||||||||||||||||| ||         ||||||     |||    
3' cggaaacuau     uagaaggu   uaggacagugucuacugagagc gg         uggugu     aag   a
             ugagc        -aa                      a  --------a      aucuu   uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr8: 56567231-56567374 [+]
intergenic
Database links

Mature sequence sly-miR1919c-5p

Accession MIMAT0032040
Sequence

31 - 

ugucgcagaugacuuucgccc

 - 51

Get sequence
Evidence experimental; Illumina [2]

Mature sequence sly-miR1919c-3p

Accession MIMAT0007913
Previous IDssly-miR1919c
Sequence

97 - 

acgagagucaucugugacagg

 - 117

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:18653800 "Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening" Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T Genome Res. 18:1602-1609(2008).
2
PMID:24376253 "Global and local perturbation of the tomato microRNA pathway by a trans-activated DICER-LIKE 1 mutant" Kravchik M, Sunkar R, Damodharan S, Stav R, Zohar M, Isaacson T, Arazi T J Exp Bot. 65:725-739(2014).