![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sly-MIR171a |
|||||
Accession | MI0008365 (change log) | ||||
Description | Solanum lycopersicum miR171a stem-loop | ||||
Gene family | MIPF0000030; MIR171_1 | ||||
Literature search |
![]()
23 open access papers mention sly-MIR171a | ||||
Stem-loop |
u c u uu c c ---- - gua au 5' gaaa ag aacu gauauuggc ugguuca ucagac aac aaaau aacuau u |||| || |||| ||||||||| ||||||| |||||| ||| ||||| |||||| 3' cuuu uc uuga cuauaaccg gccgagu aguuug uug uuuug uuggua u a c u cu u u cuuu c -ag ag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sly-miR171a |
|
Accession | MIMAT0007922 |
Sequence |
87 - ugauugagccgugccaauauc - 107 |
Evidence | experimental; 454 [1] |
References |
|
1 |
PMID:18653800
"Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening"
Genome Res. 18:1602-1609(2008).
|
2 |
PMID:18602455
"Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill"
Gene. 423:1-7(2008).
|