Stem-loop sequence ptr-mir-432

AccessionMI0008667 (change log)
DescriptionPan troglodytes miR-432 stem-loop
Gene family MIPF0000211; mir-432
Stem-loop
   -  -  c       u u     ua       g     a   u -  uu 
5'  ga cu cuccagg c uggag  ggucauu ggugg ucc c ua  u
    || || ||||||| | |||||  ||||||| ||||| ||| | ||   
3'  cu ga gagguuc g accuc  ucgguag ucacc ggg g au  c
   a  a  u       u u     -c       g     -   u c  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chr14: 86129447-86129539 [+]
sense
ENSPTRT00000054364 ; ptr-mir-432-201; exon 1
antisense
ENSPTRT00000012391 ; ptr-mir-136-201; exon 1
Clustered miRNAs
< 10kb from ptr-mir-432
ptr-mir-337chr14: 86119486-86119577 [+]
ptr-mir-665chr14: 86120026-86120096 [+]
ptr-mir-431chr14: 86125968-86126080 [+]
ptr-mir-433chr14: 86126847-86126938 [+]
ptr-mir-127chr14: 86127939-86128035 [+]
ptr-mir-432chr14: 86129447-86129539 [+]
ptr-mir-136chr14: 86129665-86129746 [+]
Database links

Mature sequence ptr-miR-432

Accession MIMAT0008146
Sequence

13 - 

ucuuggaguaggucauugggugg

 - 35

Get sequence
Evidence by similarity; MI0003133
Predicted targets

References

1
PMID:18760970 "Computational identification of novel microRNA homologs in the chimpanzee genome" Baev V, Daskalova E, Minkov I Comput Biol Chem. 33:62-70(2009).