Accession
MI0009768
Description
Bos taurus
bta-mir-196b precursor miRNA
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Bta-mir-196b is a differentially expressed microRNA identified as under-expressed in a comparative study, with a decreased fold-change of 3.66 [PMC7312616]. This miRNA is expressed at higher levels in Wagyu cattle compared to Holstein, suggesting its involvement in fat deposition regulation, potentially through the PPAR pathway which is known to influence adipocyte differentiation [PMC5341059]. Bta-mir-196b has been shown to regulate key transcription factors of the PPAR signaling pathway, namely PPARĪ±, and is implicated in the regulation of various metabolic processes including lipid and glycerophospholipid metabolism as well as glucose metabolism by targeting genes associated with these pathways [PMC5341059]. It also has been associated with the inhibition of enzymes involved in triglyceride synthesis and degradation [PMC5341059]. The up-regulation of bta-mir-196b may influence fat deposition by affecting signal translation within the PPAR pathway through its target genes [PMC5341059]. Additionally, bta-mir-196b plays a role beyond metabolism; it has been implicated in host responses to infections such as its involvement in endothelial cell proliferation during Mycobacterium avium subspecies paratuberculosis infection [PMC6162677].
Literature search
14 open access papers mention bta-mir-196b
(43 sentences)
(43 sentences)
Sequence
8531
reads,
201
reads per million, 45 experiments
aacuggucggugauuUAGGUAGUUUCCUGUUGUUGGGAuccaccuuucucucgacagcacgacacugccuucauuacuucaguug
((((((..((((((..(((((((.((.(((((((((((..........))))))))))).)).)))))))..)))))))))))).
((((((..((((((..(((((((.((.(((((((((((..........))))))))))).)).)))))))..)))))))))))).
Structure
- uc uU U C ucca aacugg ggugau AGGUAGU UC UGUUGUUGGGA c |||||| |||||| ||||||| || ||||||||||| uugacu ucauua uccguca ag acgacagcucu c g -- cu c c cuuu
Annotation confidence
Not enough data
Do you think this miRNA is real?
Genome context
chr4: 69566921-69567005 [+]
Database links
Mature bta-miR-196b
| Accession | MIMAT0009256 |
| Description | Bos taurus bta-miR-196b mature miRNA |
| Sequence | 16 - UAGGUAGUUUCCUGUUGUUGGGA - 38 |
| Evidence | not_experimental |
References
|
