miRBase entry: bta-mir-196b

Stem-loop bta-mir-196b


Accession
MI0009768
Description
Bos taurus bta-mir-196b precursor miRNA
Gene family
MIPF0000031; mir-196

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Bta-mir-196b is a microRNA that has been found to be under-expressed in cattle, specifically in Wagyu cattle compared to Holstein cattle. This suggests that bta-mir-196b may play a role in regulating fat deposition in beef through the stimulation of adipocyte differentiation via the PPAR pathway, similar to miR-519d [PMC5341059]. Bta-mir-196b, along with bta-miR-874, directly regulates the expression of PPARα and RXRα, two important transcription factors in the PPAR signaling pathway [PMC5341059]. These microRNAs may also regulate lipid metabolism, glycerophospholipid metabolism, adipocyte differentiation, and glucose metabolism by inhibiting the expression of various genes involved in the PPAR pathway [PMC5341059]. Additionally, bta-mir-196b has been implicated in endothelial cell proliferation and bta-miR-146b has been associated with bacteria recognition and regulation of inflammatory response during Mycobacterium avium subspecies paratuberculosis infection [PMC6162677]. Overall, bta-mir-196b appears to be involved in various biological processes related to fat deposition and metabolic regulation.

Literature search
14 open access papers mention bta-mir-196b
(43 sentences)

Sequence

8531 reads, 201 reads per million, 45 experiments
aacuggucggugauuUAGGUAGUUUCCUGUUGUUGGGAuccaccuuucucucgacagcacgacacugccuucauuacuucaguug
((((((..((((((..(((((((.((.(((((((((((..........))))))))))).)).)))))))..)))))))))))).

Structure
-      uc      uU       U  C           ucca 
 aacugg  ggugau  AGGUAGU UC UGUUGUUGGGA    c
 ||||||  ||||||  ||||||| || |||||||||||     
 uugacu  ucauua  uccguca ag acgacagcucu    c
g      --      cu       c  c           cuuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 69566921-69567005 [+]

Database links

Mature bta-miR-196b

Accession MIMAT0009256
Description Bos taurus bta-miR-196b mature miRNA
Sequence 16 - UAGGUAGUUUCCUGUUGUUGGGA - 38
Evidence not_experimental

References

  1. PubMed ID: 18215311
    miRNAminer: a tool for homologous microRNA gene search
    "Artzi S, Kiezun A, Shomron N"
    "BMC Bioinformatics (2008) 9:39

  2. PubMed ID: 18945293
    Annotation of 390 bovine miRNA genes by sequence similarity with other species
    "Strozzi F, Mazza R, Malinverni R, Williams JL"
    "Anim Genet (2009) 40:125