![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-335 |
|||||
Accession | MI0009804 (change log) | ||||
Description | Bos taurus miR-335 stem-loop | ||||
Gene family | MIPF0000196; mir-335 | ||||
Literature search |
![]()
11 open access papers mention bta-mir-335 | ||||
Stem-loop |
----------uuu c a c u gu 5' uggg ggggguca gagcaauaa gaaaaaug uu c |||| |||||||| ||||||||| |||||||| || 3' acuc ccuccagu cucguuauu cuuuuugc aa a acucaugucguuu u c a c au |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-335 |
|
Accession | MIMAT0009291 |
Sequence |
14 - ucaagagcaauaacgaaaaaugu - 36 |
Deep sequencing | 4905 reads, 64 experiments |
Evidence | experimental; cloned [3] |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|
3 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|