![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-33b |
|||||
Accession | MI0009808 (change log) | ||||
Description | Bos taurus miR-33b stem-loop | ||||
Gene family | MIPF0000070; mir-33 | ||||
Literature search |
![]()
15 open access papers mention bta-mir-33b | ||||
Stem-loop |
---------gcggg c c - uu g u 5' cggc ccg gg ugcauugcug gcauugcau ug g |||| ||| || |||||||||| ||||||||| || a 3' gccg ggc cc acgugacggc cgugacgug ac g cgccacgguccccg a - g uc g g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence bta-miR-33b |
|
Accession | MIMAT0009295 |
Sequence |
16 - gugcauugcuguugcauugc - 35 |
Deep sequencing | 1464 reads, 73 experiments |
Evidence | by similarity; MI0003646 |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:18945293
"Annotation of 390 bovine miRNA genes by sequence similarity with other species"
Anim Genet. 40:125(2009).
|