Stem-loop sequence mmu-mir-1931

AccessionMI0009920 (change log)
Symbol MGI:Mir1931
DescriptionMus musculus miR-1931 stem-loop
Literature search

2 open access papers mention mmu-mir-1931
(2 sentences)

Stem-loop
   --       u -    g  agaa     aacuc      u  u   - --g      -a      
5'   agccauc c cuag cc    gcauu     uuugaa gc gcu c   ucaaag  ucugu 
     ||||||| | |||| ||    |||||     |||||| || ||| |   ||||||  |||| u
3'   ucgguag g gguc gg    cguaa     aaauuu cg cga g   aguuuc  agacg 
   ac       c u    g  --aa     ccuua      -  u   a uua      cg      
Get sequence
Deep sequencing
1628 reads, 0 reads per million, 71 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 93162785-93162903 [+]
sense
ENSMUST00000069965 ; Cdk17-201; intron 1
Database links

Mature sequence mmu-miR-1931

Accession MIMAT0009394
Sequence

95 - 

augcaagggcuggugcgauggc

 - 116

Get sequence
Deep sequencing1608 reads, 72 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).