Stem-loop sequence mmu-mir-1945

AccessionMI0009934 (change log)
Symbol MGI:Mir1945
DescriptionMus musculus miR-1945 stem-loop
Literature search

1 open access papers mention mmu-mir-1945
(1 sentences)

Stem-loop
   --       c   c     u   cc    a   a   gc 
5'   cugaacu cga ucccg cag  cccg gaa acc  a
     ||||||| ||| ||||| |||  |||| ||| |||   
3'   gauuuga guu agggc guc  gggc cuu ugg  c
   uc       u   c     u   au    g   c   gc 
Get sequence
Deep sequencing
408 reads, 0 reads per million, 61 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 11254368-11254445 [-]
intergenic
Database links

Mature sequence mmu-miR-1945

Accession MIMAT0009410
Sequence

44 - 

ucuucgcggguacugucgggac

 - 65

Get sequence
Deep sequencing408 reads, 61 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).