Stem-loop sequence mmu-mir-1949

AccessionMI0009940 (change log)
Symbol MGI:Mir1949
DescriptionMus musculus miR-1949 stem-loop
Gene family MIPF0001139; mir-1949
Literature search

3 open access papers mention mmu-mir-1949
(5 sentences)

Stem-loop
   --    -             gcc     c  gc  c 
5'   gcug guuggcauucugg   ugguu au  ca c
     |||| |||||||||||||   ||||| ||  ||  
3'   ugau cgacuguaggacc   aucaa ug  gu u
   gu    a             -au     u  uu  c 
Get sequence
Deep sequencing
1917 reads, 1.28 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 35554567-35554636 [+]
sense
ENSMUST00000157434 ; Mir1949-201; exon 1
ENSMUST00000181664 ; Snhg4-201; intron 2
Database links

Mature sequence mmu-miR-1949

Accession MIMAT0009416
Sequence

46 - 

cuauaccaggaugucagcauaguu

 - 69

Get sequence
Deep sequencing1908 reads, 78 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).