Stem-loop sequence mmu-mir-1950

AccessionMI0009941 (change log)
Symbol MGI:Mir1950
DescriptionMus musculus miR-1950 stem-loop
Stem-loop
                c      u        uu  uug 
5' gcuuuuucugcau uaagga auggucau  aa   u
   ||||||||||||| |||||| ||||||||  ||    
3' cgaaaaagacgua auuccu uacuagua  uu   u
                a      c        cc  uuu 
Get sequence
Deep sequencing
280 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 34965396-34965469 [+]
sense
ENSMUST00000087341 ; Kif20b-201; intron 25
Database links

Mature sequence mmu-miR-1950

Accession MIMAT0009417
Sequence

7 - 

ucugcaucuaaggauaugguca

 - 28

Get sequence
Deep sequencing274 reads, 49 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).