Stem-loop sequence mmu-mir-1951

AccessionMI0009946 (change log)
Symbol MGI:Mir1951
DescriptionMus musculus miR-1951 stem-loop
Stem-loop
   --u   ug  -       aaa -    uc        u    c gaa 
5'    ggg  gg gguuuag   c cacc  ucuucacu acuu u   a
      |||  || |||||||   | ||||  |||||||| |||| |    
3'    ucc  uc ccaaauc   g gugg  agagguga ugga a   g
   ccc   gu  u       --g u    uc        -    a auu 
Get sequence
Deep sequencing
204 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 115638725-115638813 [+]
sense
OTTMUST00000036061 ; RP23-297K24.1-001; intron 3
OTTMUST00000036062 ; RP23-297K24.1-002; intron 3
ENSMUST00000110918 ; BC052040-001; intron 3
ENSMUST00000147968 ; BC052040-002; intron 3
ENSMUST00000166472 ; BC052040-201; intron 3
Database links

Mature sequence mmu-miR-1951

Accession MIMAT0009422
Sequence

53 - 

guaguggagacugguguggcua

 - 74

Get sequence
Deep sequencing178 reads, 41 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).