Stem-loop sequence mmu-mir-1953

AccessionMI0009948 (change log)
Symbol MGI:Mir1953
DescriptionMus musculus miR-1953 stem-loop
Stem-loop
   --  u      u  ucuu   a  g   u   g      agaa  u 
5'   gg gcugcc gg    ggg aa uuc cag cuucug    uu g
     || |||||| ||    ||| || ||| ||| ||||||    || c
3'   cc cgacgg cc    ccc uu gag guc gaagac    ag a
   au  -      u  uucu   c  g   u   g      ---g  g 
Get sequence
Deep sequencing
416 reads, 4.29 reads per million, 70 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 151967529-151967617 [-]
intergenic
Database links

Mature sequence mmu-miR-1953

Accession MIMAT0009424
Sequence

16 - 

ugggaaaguucucaggcuucug

 - 37

Get sequence
Deep sequencing394 reads, 67 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).