Stem-loop sequence mmu-mir-1954

AccessionMI0009949 (change log)
Symbol MGI:Mir1954
DescriptionMus musculus miR-1954 stem-loop
Gene family MIPF0001275; mir-1954
Literature search

1 open access papers mention mmu-mir-1954
(1 sentences)

Stem-loop
   g   uc      aa     g  u           guuuguuu 
5'  agg  agccag  cugca ag gagacccuguu        g
    |||  ||||||  ||||| || |||||||||||         
3'  ucc  ucgguc  gaugu uc cuuuggggcag        u
   a   ua      cc     g  u           aguuuguu 
Get sequence
Deep sequencing
19739 reads, 3.2e+03 reads per million, 154 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 32652329-32652414 [+]
sense
OTTMUST00000028346 ; Eng-001; intron 1
OTTMUST00000028347 ; Eng-002; intron 1
ENSMUST00000009705 ; Eng-001; intron 1
ENSMUST00000113272 ; Eng-002; intron 1
ENSMUST00000167841 ; Eng-201; intron 1
Database links

Mature sequence mmu-miR-1954

Accession MIMAT0009425
Sequence

14 - 

acugcagagugagacccuguu

 - 34

Get sequence
Deep sequencing214 reads, 49 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).