Stem-loop sequence mmu-mir-1963

AccessionMI0009960 (change log)
Symbol MGI:Mir1963
DescriptionMus musculus miR-1963 stem-loop
Literature search

1 open access papers mention mmu-mir-1963
(1 sentences)

Stem-loop
   -cu        auca    g      ug   
5'    gggacgag    ugag ccuucc  gc 
      ||||||||    |||| ||||||  | c
3'    cccuguuc    gcuc ggaagg  ca 
   acg        -ccg    a      gu   
Get sequence
Deep sequencing
33 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 29083636-29083694 [-]
sense
ENSMUST00000179893 ; Ryr1-202; intron 34
ENSMUST00000032813 ; Ryr1-201; intron 34
Database links

Mature sequence mmu-miR-1963

Accession MIMAT0009436
Sequence

2 - 

ugggacgagaucaugaggccuuc

 - 24

Get sequence
Deep sequencing27 reads, 7 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).