Stem-loop sequence mmu-mir-1968

AccessionMI0009965 (change log)
Symbol MGI:Mir1968
DescriptionMus musculus miR-1968 stem-loop
Stem-loop
         cu        ua   a      -a   u 
5' ccuccu  gcagcugu  agg uggugg  cua u
   ||||||  ||||||||  ||| ||||||  |||  
3' ggagga  ugucgacg  ucc accacc  gau g
         au        uc   -      gg   u 
Get sequence
Deep sequencing
2028 reads, 25 reads per million, 72 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 13189031-13189098 [-]
sense
ENSMUST00000165605 ; Grtp1-201; intron 4
Database links

Mature sequence mmu-miR-1968-5p

Accession MIMAT0009441
Previous IDsmmu-miR-1968
Sequence

8 - 

ugcagcuguuaaggaugguggacu

 - 31

Get sequence
Deep sequencing1978 reads, 66 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence mmu-miR-1968-3p

Accession MIMAT0017350
Previous IDsmmu-miR-1968*
Sequence

44 - 

accaccucugcagcuguuaag

 - 64

Get sequence
Deep sequencing49 reads, 20 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).