Stem-loop sequence mmu-mir-1969

AccessionMI0009966 (change log)
Symbol MGI:Mir1969
DescriptionMus musculus miR-1969 stem-loop
Stem-loop
   aua   -   g     ga        a uuuaa        cuc    aa 
5'    gug cua aggcu  agauggag c     caugggug   uuaa  u
      ||| ||| |||||  |||||||| |     ||||||||   ||||   
3'    uac gau ucugg  uuuaccuc g     guaccuac   aauu  c
   -ac   a   g     uc        c ---uc        ---    gu 
Get sequence
Deep sequencing
547 reads, 0 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 70925525-70925618 [+]
intergenic
Database links

Mature sequence mmu-miR-1969

Accession MIMAT0009442
Sequence

17 - 

aagauggagacuuuaacaugggu

 - 39

Get sequence
Deep sequencing518 reads, 71 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).