Stem-loop sequence mmu-mir-1970

AccessionMI0009968 (change log)
Symbol MGI:Mir1970
DescriptionMus musculus miR-1970 stem-loop
Literature search

1 open access papers mention mmu-mir-1970
(1 sentences)

Stem-loop
   --   g    uu  ---u      -aau           ga a    uu   g  u 
5'   gau ugca  gu    ggagga    gugucacuggg  u ggcu  gag uu c
     ||| ||||  ||    ||||||    |||||||||||  | ||||  ||| ||  
3'   cua acgu  cg    ccuucu    cacggugaucc  a cuga  cuc aa a
   uc   g    -c  uugu      cacu           gg -    --   g  g 
Get sequence
Deep sequencing
565 reads, 391 reads per million, 85 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 135786114-135786217 [-]
antisense
OTTMUST00000045110 ; Gprasp1-001; intron 4
OTTMUST00000045111 ; Gprasp1-002; intron 5
OTTMUST00000045112 ; Gprasp1-003; intron 5
ENSMUST00000113144 ; Gprasp1-001; intron 4
ENSMUST00000113147 ; Gprasp1-002; intron 5
ENSMUST00000113145 ; Gprasp1-003; intron 5
Database links

Mature sequence mmu-miR-1970

Accession MIMAT0009444
Sequence

22 - 

ugugucacuggggauaggcuuug

 - 44

Get sequence
Deep sequencing469 reads, 64 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).