Stem-loop sequence bmo-mir-285

AccessionMI0009997 (change log)
DescriptionBombyx mori miR-285 stem-loop
Gene family MIPF0000009; mir-29
Literature search

2 open access papers mention bmo-mir-285
(2 sentences)

Stem-loop
   ugu        u  ca    u         u   ga    uu u 
5'    ccauguuu ga  acug auucgagug gug  agag  u a
      |||||||| ||  |||| ||||||||| |||  ||||  | a
3'    ggugcaag cu  ugac uaagcuuac cac  ucuc  a a
   auu        -  cg    u         -   ga    cu a 
Get sequence
Deep sequencing
107 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582025.1: 2320232-2320320 [-]
intergenic
Database links

Mature sequence bmo-miR-285

Accession MIMAT0009154
Sequence

55 - 

uagcaccauucgaauucagugc

 - 76

Get sequence
Deep sequencing105 reads, 3 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links

References

1
PMID:18714353 "The silkworm (Bombyx mori) microRNAs and their expressions in multiple developmental stages" Yu X, Zhou Q, Li SC, Luo Q, Cai Y, Lin WC, Chen H, Yang Y, Hu S, Yu J PLoS One. 3:e2997(2008).
2
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).