Stem-loop sequence cfa-mir-367

AccessionMI0010354 (change log)
DescriptionCanis familiaris miR-367 stem-loop
Gene family MIPF0000162; mir-367
Stem-loop
       g           ua     cucug      a 
5' ccau acuguugcuaa  ugcaa     uucaau c
   |||| |||||||||||  |||||     ||||||  
3' ggua ugguaacgauu  acguu     agguua a
       g           uc     ----a      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr32: 32428905-32428972 [-]
antisense
ENSCAFT00000018607 ; LARP7-201; intron 8
Clustered miRNAs
< 10kb from cfa-mir-367
cfa-mir-302bchr32: 32429500-32429574 [-]
cfa-mir-302cchr32: 32429366-32429433 [-]
cfa-mir-302achr32: 32429209-32429277 [-]
cfa-mir-302dchr32: 32429032-32429101 [-]
cfa-mir-367chr32: 32428905-32428972 [-]
Database links

Mature sequence cfa-miR-367

Accession MIMAT0009859
Sequence

6 - 

acuguugcuaauaugcaacucu

 - 27

Get sequence
Evidence by similarity; MI0000775
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).