Stem-loop sequence cfa-mir-376c

AccessionMI0010387 (change log)
DescriptionCanis familiaris miR-376c stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
   u        u    g     ua     u         uguua 
5'  uugguauu aaaa gugga  uuccu cuauguuua     u
    |||||||| |||| |||||  ||||| |||||||||     u
3'  aacuauga uuuu caccu  aagga gauacaaau     u
   a        c    g     ua     -         uggua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69270100-69270185 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-376c
cfa-mir-494chr8: 69261385-69261465 [+]
cfa-mir-543chr8: 69263406-69263463 [+]
cfa-mir-495chr8: 69265169-69265226 [+]
cfa-mir-3958chr8: 69267134-69267274 [+]
cfa-mir-376a-3chr8: 69269752-69269810 [+]
cfa-mir-376cchr8: 69270100-69270185 [+]
cfa-mir-376a-2chr8: 69270499-69270556 [+]
cfa-mir-376bchr8: 69270858-69270956 [+]
cfa-mir-376a-1chr8: 69271259-69271316 [+]
cfa-mir-300chr8: 69271815-69271892 [+]
cfa-mir-1185chr8: 69273204-69273332 [+]
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
cfa-mir-544chr8: 69277656-69277744 [+]
Database links

Mature sequence cfa-miR-376c

Accession MIMAT0009888
Sequence

16 - 

guggauauuccuucuauguuua

 - 37

Get sequence
Evidence by similarity; MI0003533
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).