Stem-loop sequence cfa-mir-544

AccessionMI0010409 (change log)
DescriptionCanis familiaris miR-544 stem-loop
Gene family MIPF0000436; mir-544
Stem-loop
   auuuu      cua    u           -     u   gauuu 
5'      caucac   ggga cuuguuaaaag gcaga ucu     a
        ||||||   |||| ||||||||||| ||||| |||     g
3'      guagug   cccu gaacgauuuuu cgucu aga     g
   --auc      -aa    u           a     u   accag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69277656-69277744 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-544
cfa-mir-376a-3chr8: 69269752-69269810 [+]
cfa-mir-376cchr8: 69270100-69270185 [+]
cfa-mir-376a-2chr8: 69270499-69270556 [+]
cfa-mir-376bchr8: 69270858-69270956 [+]
cfa-mir-376a-1chr8: 69271259-69271316 [+]
cfa-mir-300chr8: 69271815-69271892 [+]
cfa-mir-1185chr8: 69273204-69273332 [+]
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
cfa-mir-544chr8: 69277656-69277744 [+]
cfa-mir-487achr8: 69281078-69281157 [+]
cfa-mir-382chr8: 69283123-69283179 [+]
cfa-mir-134chr8: 69283496-69283568 [+]
cfa-mir-485chr8: 69284239-69284297 [+]
Database links

Mature sequence cfa-miR-544

Accession MIMAT0009910
Sequence

55 - 

auucugcauuuuuagcaaguuc

 - 76

Get sequence
Evidence by similarity; MI0003515
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).