Stem-loop sequence aga-mir-988

AccessionMI0010598 (change log)
DescriptionAnopheles gambiae miR-988 stem loop
Gene family MIPF0000724; mir-988
Literature search

1 open access papers mention aga-mir-988
(1 sentences)

Stem-loop
   cug    gcauug               u u    ug   -----    g      u 
5'    ugga      gacauugccggugug g uuug  aca     auga auuuaa a
      ||||      ||||||||||||||| | ||||  |||     |||| ||||||  
3'    gccu      uuguggcggucgcac c aaac  ugu     uacu ugaauu g
   --a    ------               u c    gu   ucccc    -      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
chr2L: 39359054-39359155 [+]
intergenic
Database links

Mature sequence aga-miR-988

Accession MIMAT0010104
Sequence

66 - 

ccccuuguugcaaaccucacgc

 - 87

Get sequence
Evidence by similarity; MI0005847

References

1
" Griffiths-Jones S Unpublished (2009).