Stem-loop sequence sma-mir-125a

AccessionMI0010676 (change log)
DescriptionSchistosoma mansoni miR-125a stem-loop
Gene family MIPF0000733; mir-125_2
Literature search

3 open access papers mention sma-mir-125a
(7 sentences)

Stem-loop
   -  -uc      a c     au     -----      -    a 
5'  gc   ccugag c cuuug  ugccu     uguuau uaca u
    ||   |||||| | |||||  |||||     |||||| ||||  
3'  cg   ggacuc g gaaac  acgga     acaaua augu a
   a  uau      a u     cg     cuagu      c    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_1: 38691263-38691344 [-]
intergenic
Database links

Mature sequence sma-miR-125a-5p

Accession MIMAT0010183
Previous IDssma-miR-125a
Sequence

3 - 

ucccugagacccuuugauugcc

 - 24

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

Mature sequence sma-miR-125a-3p

Accession MIMAT0032105
Sequence

59 - 

cagccaaagugacucaggu

 - 77

Get sequence
Evidence experimental; Illumina [2], SOLiD [2]

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).
2
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).