Stem-loop mtr-MIR2119

Accession

MI0010698

Description

Medicago truncatula mtr-MIR2119 precursor miRNA

Sequence

uuuauuuuuuuuacacuaagauacucccuacuuuccuuugauuggaaauaaagagagacaaaaagguaaauuuaauuucucuucuuaugucaaUCAAAGGGAGGUGUGGAGUAGagguguaaaaaguaaa
......(((((((((((....((((((.(((((((((((((((((..((((.((((((...(((......)))....)))))).)))).))))))))))))))))).))))))..)))))))))))....

Structure

uuuauu           aaga      c                 aa    a      -caa   gg 
      uuuuuuacacu    uacucc uacuuuccuuugauugg  auaa gagaga    aaa  u
      |||||||||||    |||||| |||||||||||||||||  |||| ||||||    |||   
      gaaaaaugugg    AUGAGG GUGGAGGGAAACUaacu  uauu uucucu    uuu  a
--aaau           --aG      U                 -g    c      uuaa   aa 

Annotation confidence Low

Genome context

chr5: 18765366-18765495 [-]

Clustered miRNAs

1 other miRNA is < 10 kb from mtr-MIR2119

Mature mtr-miR2119

• Accession: MIMAT0011168
• Description: Medicago truncatula mtr-miR2119 mature miRNA
• Sequence: 94 - UCAAAGGGAGGUGUGGAGUAG - 114
• Evidence: experimental ; 454 [2-3], Northern [2]

References

1. PubMed ID: 19555436
   Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families
   "Jagadeeswaran G, Zheng Y, Li YF, Shukla LI, Matts J, Hoyt P, Macmil SL, Wiley GB, Roe BA, Zhang W, Sunkar R"
   "New Phytol (2009) 184:85-98


2. PubMed ID: 19767456
   Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules
   "Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M"
   "Plant Cell (2009) 21:2780-2796


3. PubMed ID: 19353277
   Conserved and novel miRNAs in the legume Phaseolus vulgaris in response to stress
   "Arenas-Huertero C, Perez B, Rabanal F, Blanco-Melo D, De la Rosa C, Estrada-Navarrete G, Sanchez F, Covarrubias AA, Reyes JL"
   "Plant Mol Biol (2009) 70:385-401