![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR1509b |
|||||
Accession | MI0010730 (change log) | ||||
Description | Glycine max miR1509b stem-loop | ||||
Gene family | MIPF0000771; MIR1509 | ||||
Literature search |
![]()
13 open access papers mention gma-MIR1509b | ||||
Stem-loop |
cu c u u gugu aaag cuuc 5' gcau uuuuuaaucaaggaaa cacggu ga gaaggagag ugg a |||| |||||||||||||||| |||||| || ||||||||| ||| 3' ugua agaaauugguuccuuu guguca cu cuuccuuuu gcc g cg u - c ---- --gg uuua |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR1509b |
|
Accession | MIMAT0011201 |
Sequence |
11 - uuaaucaaggaaaucacgguu - 31 |
Evidence | experimental; cloned [1], Illumina [2,4-5], 454 [3] |
References |
|
1 |
PMID:19084500
"Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules"
Biochem Biophys Res Commun. 378:799-803(2009).
|
2 |
PMID:20122185
"Prediction of novel miRNAs and associated target genes in Glycine max"
BMC Bioinformatics. 11 Suppl 1:S14(2010).
|
3 |
PMID:21504877
"MicroRNAs in the shoot apical meristem of soybean"
J Exp Bot. 62:2495-2506(2011).
|
4 |
PMID:22156213
"MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs"
Genes Dev. 25:2540-2553(2011).
|
5 |
PMID:24475082
"Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons"
PLoS One. 9:e86153(2014).
|