Stem-loop sequence gma-MIR1509b

AccessionMI0010730 (change log)
DescriptionGlycine max miR1509b stem-loop
Gene family MIPF0000771; MIR1509
Literature search

13 open access papers mention gma-MIR1509b
(27 sentences)

Stem-loop 
   cu    c                u      u  gugu         aaag   cuuc 
5'   gcau uuuuuaaucaaggaaa cacggu ga    gaaggagag    ugg    a
     |||| |||||||||||||||| |||||| ||    |||||||||    |||     
3'   ugua agaaauugguuccuuu guguca cu    cuuccuuuu    gcc    g
   cg    u                -      c  ----         --gg   uuua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 1350441-1350549 [+]
intergenic
Database links

Mature sequence gma-miR1509b

Accession MIMAT0011201
Sequence

11 -  

uuaaucaaggaaaucacgguu

 - 31

Get sequence
Evidence experimental; cloned [1], Illumina [2,4-5], 454 [3]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
2
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
3
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
5
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).