Stem-loop gma-MIR1509b

Accession

MI0010730

Description

Glycine max gma-MIR1509b precursor miRNA

Gene family

MIPF0000771; MIR1509

Literature search

13 open access papers mention gma-MIR1509b
(27 sentences)

Sequence

cugcaucuuuUUAAUCAAGGAAAUCACGGUUgagugugaaggagagaaaguggcuucagauuuccggguuuuccuucuccacuguguuuccuugguuaaagauaugugc
..((((.((((((((((((((((.((((((.((....(((((((((....(((..........)))..))))))))))).)))))))))))))))))))))).))))..

Structure

cu    c                U      U  gugu         aaag   cuuc 
  gcau uuuUUAAUCAAGGAAA CACGGU ga    gaaggagag    ugg    a
  |||| |||||||||||||||| |||||| ||    |||||||||    |||     
  ugua agaaauugguuccuuu guguca cu    cuuccuuuu    gcc    g
cg    u                -      c  ----         --gg   uuua 

Annotation confidence Not enough data

Genome context

chr5: 1350441-1350549 [+]

Mature gma-miR1509b

• Accession: MIMAT0011201
• Description: Glycine max gma-miR1509b mature miRNA
• Sequence: 11 - UUAAUCAAGGAAAUCACGGUU - 31
• Evidence: experimental ; cloned [1], Illumina [2,4-5], 454 [3]

References

1. PubMed ID: 20122185
   Prediction of novel miRNAs and associated target genes in Glycine max
   Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
   BMC Bioinformatics (2010) 11:S14


2. PubMed ID: 19084500
   Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules
   "Wang Y, Li P, Cao X, Wang X, Zhang A, Li X"
   "Biochem Biophys Res Commun (2009) 378:799-803


3. PubMed ID: 21504877
   MicroRNAs in the shoot apical meristem of soybean
   "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
   "J Exp Bot (2011) 62:2495-2506


4. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


5. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153