Stem-loop sequence bta-mir-2316

AccessionMI0011336 (change log)
DescriptionBos taurus miR-2316 stem-loop
Literature search

1 open access papers mention bta-mir-2316
(1 sentences)

Stem-loop
        -uccca       cu  a   c     ga   u 
5' cgcua      cuccggc  gg cug ggcgg  ggc g
   |||||      |||||||  || ||| |||||  |||  
3' gugau      gaggucg  cc gac ccgcc  cug c
        cuaucc       uu  c   -     -g   u 
Get sequence
Deep sequencing
81 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr15: 47491046-47491120 [+]
intergenic
Database links

Mature sequence bta-miR-2316

Accession MIMAT0011837
Sequence

10 - 

acuccggccuggacugcggcggg

 - 32

Get sequence
Deep sequencing81 reads, 29 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).