![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-1343 |
|||||
Accession | MI0011338 (change log) | ||||
Description | Bos taurus miR-1343 stem-loop | ||||
Gene family | MIPF0001206; mir-1343 | ||||
Literature search |
2 open access papers mention bta-mir-1343 | ||||
Stem-loop |
u u u a c -c ucu 5' ggcu cgg gc gggg gcgg ccccggg gggcc g |||| ||| || |||| |||| ||||||| ||||| 3' ccgg gcc cg ucuc cgcc ggggucc cccgg c - u c a c uc ucu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-1343-5p |
|
Accession | MIMAT0011839 |
Previous IDs | bta-miR-1343 |
Sequence |
12 - uggggagcggcccccgggcggg - 33 |
Deep sequencing | 15 reads, 12 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
Mature sequence bta-miR-1343-3p |
|
Accession | MIMAT0011840 |
Previous IDs | bta-miR-1343* |
Sequence |
49 - cuccuggggcccgcacucuc - 68 |
Deep sequencing | 1629 reads, 69 experiments |
Evidence | experimental; Illumina [1-2] |
Predicted targets |
|
References |
|
1 |
PMID:19633723
"Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection"
PLoS One. 4:e6349(2009).
|
2 |
PMID:21912509
"Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle"
Int J Biol Sci. 7:1016-1026(2011).
|