Stem-loop sequence bta-mir-2335

AccessionMI0011361 (change log)
DescriptionBos taurus miR-2335 stem-loop
Gene family MIPF0001971; mir-2335
Literature search

1 open access papers mention bta-mir-2335
(1 sentences)

Stem-loop
        u   g    cu      a   -au    uug 
5' guaga aau auga  aacuga uug   gacu   g
   ||||| ||| ||||  |||||| |||   ||||    
3' uaucu uua uacu  uugacu aau   uugg   g
        -   g    --      -   gau    uac 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 7 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 22768275-22768343 [+]
sense
ENSBTAT00000025501 ; GLOD4-201; intron 3
Database links

Mature sequence bta-miR-2335

Accession MIMAT0011868
Sequence

3 - 

agauaaugaugacuaacugaau

 - 24

Get sequence
Deep sequencing10 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).