Stem-loop sequence bta-mir-2356

AccessionMI0011385 (change log)
DescriptionBos taurus miR-2356 stem-loop
Literature search

1 open access papers mention bta-mir-2356
(1 sentences)

Stem-loop
        cu      uuguga      a    ga     c 
5' ggaag  uuucuc      ugaggg gucu  ggagc c
   |||||  ||||||      |||||| ||||  |||||  
3' ucuuc  gaaggg      auuucc uagg  cuuug a
        ac      ----ug      g    -a     u 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr2: 107111453-107111525 [-]
sense
ENSBTAT00000003229 ; TNS1-201; intron 2
Database links

Mature sequence bta-miR-2356

Accession MIMAT0011893
Sequence

12 - 

ucuugugaugagggagucugagg

 - 34

Get sequence
Deep sequencing10 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).