![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-1777b |
|||||
Accession | MI0011520 (change log) | ||||
Description | Bos taurus miR-1777b stem-loop | ||||
Literature search |
3 open access papers mention bta-mir-1777b | ||||
Stem-loop |
gc ----- augg g --- au 5' cug ucucucugu ugcc caccg cc ggag g ||| ||||||||| |||| ||||| || |||| 3' gac ggagggacg gcgg guggc gg ucuc a -a uuggg -ggg g ggg gg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence bta-miR-1777b |
|
Accession | MIMAT0012046 |
Sequence |
46 - gggggcgguggggggcgggg - 65 |
Deep sequencing | 11 reads, 7 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:19633723
"Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection"
PLoS One. 4:e6349(2009).
|