Stem-loop sequence bta-mir-2464

AccessionMI0011524 (change log)
DescriptionBos taurus miR-2464 stem-loop
Literature search

1 open access papers mention bta-mir-2464
(1 sentences)

Stem-loop
      a  g c       g   ac     a   -  g 
5' aag au a uucugcu cag  cugga gac au g
   ||| || | ||||||| |||  ||||| ||| || a
3' uuc ua u aagacga guc  gaccu cug ua g
      a  g c       -   ga     -   a  a 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr7: 93149817-93149886 [+]
intergenic
Database links

Mature sequence bta-miR-2464-5p

Accession MIMAT0012051
Sequence

8 - 

acuucugcugcagaccuggaagac

 - 31

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence bta-miR-2464-3p

Accession MIMAT0012052
Sequence

44 - 

cuccagagcugagcagaacug

 - 64

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).