Stem-loop sequence bmo-mir-2846

AccessionMI0012466 (change log)
DescriptionBombyx mori miR-2846 stem-loop
Literature search

1 open access papers mention bmo-mir-2846
(1 sentences)

Stem-loop
   aauaua    -      a  aa g   ua      acg   gaa   a 
5'       ucgu gggauu cu  u gcg  gugcga   cgu   ccg g
         |||| |||||| ||  | |||  ||||||   |||   ||| a
3'       ggcg cccuga ga  a cgu  uaugcu   gca   ggu c
   gacaga    g      a  -- g   gg      -ga   -aa   g 
Get sequence
Deep sequencing
101 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582028.1: 1624734-1624827 [-]
intergenic
Database links

Mature sequence bmo-miR-2846

Accession MIMAT0013767
Sequence

11 - 

gggauuacuaauggcguagugcg

 - 33

Get sequence
Deep sequencing101 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).