Stem-loop sequence oan-mir-29b-2

AccessionMI0012554 (change log)
DescriptionOrnithorhynchus anatinus miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
            -          c      g  u    uuuucc 
5' cuucuggaa gcugguuuca auggug cu agau      a
   ||||||||| |||||||||| |||||| || ||||       
3' gaggauuuu ugacuaaagu uaccac ga ucua      u
            g          u      -  -    ugucuc 
Get sequence
Deep sequencing
27835 reads, 300 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
7: 38484593-38484673 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-29b-2
oan-mir-29b-27: 38484593-38484673 [-]
oan-mir-29a-27: 38484002-38484114 [-]
Database links

Mature sequence oan-miR-29b-3p

Accession MIMAT0006809
Previous IDsoan-miR-29b
Sequence

52 - 

uagcaccauuugaaaucagugu

 - 73

Get sequence
Deep sequencing52661 reads, 5 experiments
Evidence not experimental
Database links

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).