Stem-loop sequence bmo-mir-2859

AccessionMI0013002 (change log)
DescriptionBombyx mori miR-2859 stem-loop
Literature search

1 open access papers mention bmo-mir-2859
(1 sentences)

Stem-loop
   cgca   g  ga -    g g  c    -ua  uuac   g 
5'     ccu ag  g ccug c ga cagu   ug    gau a
       ||| ||  | |||| | || ||||   ||    ||| a
3'     ggg uc  c ggac g cu guua   ac    cua c
   cuca   g  aa a    g g  a    uca  cccc   a 
Get sequence
Deep sequencing
26 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004614999.1: 369-451 [-]
intergenic
Database links

Mature sequence bmo-miR-2859

Accession MIMAT0013799
Sequence

51 - 

caacuauugaucgggcaggacaa

 - 73

Get sequence
Deep sequencing21 reads, 3 experiments
Evidence not experimental
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).