miRBase entry: ssc-let-7e

Stem-loop ssc-let-7e


Accession
MI0013086
Description
Sus scrofa ssc-let-7e precursor miRNA
Gene family
MIPF0000002; let-7

Literature search
40 open access papers mention ssc-let-7e
(144 sentences)

Sequence

693 reads, 219 reads per million, 13 experiments
gccccgggcUGAGGUAGGAGGUUGUAUAGUUgaggaggacacccacggagaucacuauacggccuccuagcuuuccccag
.....(((..(((.((((((((((((((((.((...(........).....)))))))))))))))))).)))..)))..

Structure
gcccc   cU   G                U  --gga gac 
     ggg  GAG UAGGAGGUUGUAUAGU ga     g   a
     |||  ||| |||||||||||||||| ||     |    
     ccc  uuc auccuccggcauauca cu     c   c
---ga   cu   g                -  agagg acc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr6: 51858376-51858455 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from ssc-let-7e
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ssc-let-7e

Accession MIMAT0013866
Description Sus scrofa ssc-let-7e mature miRNA
Sequence 10 - UGAGGUAGGAGGUUGUAUAGUU - 31
Evidence experimental
Illumina [1,3-4], cloned [2]

References

  1. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  2. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  3. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  4. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100