![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-mir-29a |
||||||
Accession | MI0013090 (change log) | |||||
Description | Sus scrofa miR-29a stem-loop | |||||
Gene family | MIPF0000009; mir-29 | |||||
Literature search |
![]()
32 open access papers mention ssc-mir-29a | |||||
Stem-loop |
uuagagg uuu c ucaa 5' cccc augacugauuuc ugguguu agag u |||| |||||||||||| ||||||| |||| a 3' gggg uauuggcuaaag accacga ucuu u uuaguaa ucu - uuaa |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence ssc-miR-29a-5p |
|
Accession | MIMAT0037364 |
Sequence |
15 - acugauuucuuuugguguucag - 36 |
Deep sequencing | 20 reads, 8 experiments |
Evidence | experimental; Illumina [5], 454 [6] |
Mature sequence ssc-miR-29a-3p |
|
Accession | MIMAT0013870 |
Sequence |
52 - cuagcaccaucugaaaucgguua - 74 |
Deep sequencing | 7182 reads, 15 experiments |
Evidence | experimental; Illumina [1,3-4], cloned [2] |
References |
|
1 |
PMID:19917043
"MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
Anim Genet. 41:159-168(2010).
|
2 |
PMID:20180025
"Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
Mol Biol Rep. 37:3567-3574(2010).
|
3 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
4 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|
5 |
PMID:25230983
"The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing"
J Appl Genet. 56:239-252(2015).
|
6 |