miRBase entry: ssc-mir-29a

Stem-loop ssc-mir-29a


Accession
MI0013090
Description
Sus scrofa ssc-mir-29a precursor miRNA
Gene family
MIPF0000009; mir-29

Literature search
32 open access papers mention ssc-mir-29a
(100 sentences)

Sequence

343 reads, 216 reads per million, 11 experiments
ccccuuagaggaugACUGAUUUCUUUUGGUGUUCAGagucaauauaauuuuCUAGCACCAUCUGAAAUCGGUUAuaaugauugggg
((((....(..((((((((((((...(((((((.((((...........)))))))))))...))))))))))))..)....))))

Structure
    uuag gg            UUU       C    ucaa 
cccc    a  augACUGAUUUC   UGGUGUU AGag    u
||||    |  ||||||||||||   ||||||| ||||    a
gggg    u  uAUUGGCUAAAG   ACCACGA UCuu    u
    uuag aa            UCU       -    uuaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr18: 19035225-19035310 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from ssc-mir-29a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ssc-miR-29a-3p

Accession MIMAT0013870
Description Sus scrofa ssc-miR-29a-3p mature miRNA
Sequence 52 - CUAGCACCAUCUGAAAUCGGUUA - 74
Evidence experimental
Illumina [1,3-4], cloned [2]

Mature ssc-miR-29a-5p

Accession MIMAT0037364
Description Sus scrofa ssc-miR-29a-5p mature miRNA
Sequence 15 - ACUGAUUUCUUUUGGUGUUCAG - 36
Evidence experimental
Illumina [5], 454 [6]

References

  1. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  2. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  3. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  4. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100

  5. PubMed ID: 25230983
    The characteristics of the porcine (Sus scrofa) liver miRNAome with the use of next generation sequencing
    "Pawlina K, Gurgul A, Oczkowicz M, Bugno-Poniewierska M"
    "J Appl Genet (2015) 56:239-252

  6. PubMed ID: 25934266
    Evaluation of the capability of the PCV2 genome to encode miRNAs: lack of viral miRNA expression in an experimental infection
    Núñez-Hernández F, Pérez LJ, Vera G, Córdoba S, Segalés J, Sánchez A, Núñez JI
    Vet Res (2015) 46:48